Page 175 - 2020_08-Haematologica-web

Apoptosis induced by selective BH3-mimetics
BCL-2 was identified as the target for the t(14;18)(q32.3;q21.3) chromosomal translocation involv- ing the BCL2 gene with the immunoglobulin heavy chain transcriptional enhancer in follicular lymphoma and related B-cell malignancies including diffuse large B-cell lymphoma (DLBCL).2 This chromosomal translocation results in constitutive expression of BCL-2 and increased resistance to apoptosis. About 40% of DLBCL display high expression of BCL-2, not only due to t(14;18)(q32.3;q21.3) but also due to gene copy number alterations and amplifications.3 These genetic changes are associated with poor prognosis, particularly when combined with those affecting MYC in double-hit lym- phomas.4,5 Apart from these genetic changes, BCL2 is also among the most commonly mutated genes in DLBCL,6 with 91/393 cases reported as mutated in the COSMIC database (cancer.sanger.ac.uk/cosmic). In compar- ison, mutations involving MCL-1 (3/391) or BCL-XL (0/391) are rare in DLBCL. A recent study analyzed the protein expression of BCL-2, BCL-XL and MCL-1 in a large set of DLBCL cell lines and patients’ tissues and confirmed high expression of these anti-apoptotic pro- teins.7 RNA sequencing data obtained from a large cohort of DLBCL patients (n=584) indicated high expression of all main anti-apoptotic BCL-2 proteins in DLBCL.8
Elevated expression of anti-apoptotic BCL-2 proteins in cancer makes these proteins promising targets for the development of novel therapeutics. The first inhibitor for clinical use, ABT-199 (venetoclax), selectively targets BCL-2 and has been approved for the treatment of chron- ic lymphocytic leukemia and acute myeloid leukemia.9-11 Chronic lymphocytic leukemia cells display uniform sen- sitivity to ABT-199 and clinical responses are observed irrespective of genotype, demonstrating that the most important anti-apoptotic protein in chronic lymphocytic leukemia is BCL-2.12
In this study, we hypothesized that other BCL-2 family proteins, such as BCL-XL and MCL-1, are important ther- apeutic targets in DLBCL. Here, for the first time directly comparing specific BH3-mimetics that target either BCL- 2 (ABT-199).13 BCL-XL (A1331852)14 or MCL-1 (S63845)15 in an extensive panel of DLBCL cell lines and primary cells, we identified subgroups of DLBCL that depended on individual BCL-2 family proteins for survival. Dependency was associated with the presence of pre- formed complexes of the respective anti-apoptotic BCL- 2 protein with BIM, BAX and BAK, indicating that sensi- tive cells were highly primed and that sequestration of BAX/BAK by anti-apoptotic BCL-2 proteins was neces- sary for cellular survival.
Methods
Materials
All chemicals apart from ABT-199, A1331852, A1155463, A1210477 (Selleck Chemicals, Houston, TX, USA), and S63845 (ApexBio, Taiwan) were from Sigma (Deisenhofen, Germany). Most cell lines used in this study were obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ; Braunschweig, Germany) except Pfeiffer and SUDHL2 cells (American Type Culture Collection; Manassas, VA, USA), OCI- LY10 (Sandeep Dave, Duke University, Durham, NC, USA), MedB116 (Peter Moeller, University of Ulm, Ulm, Germany) and Karpas-110617 (Abraham Karpas, University of Cambridge,
Cambridge, UK). All cell lines were authenticated by short tan- dem repeat profiling and routinely tested for mycoplasma con- tamination. Primary patient-derived samples were obtained from patients attending the University Hospital of Leicester, UK. Local ethical approval (Leicestershire, Northamptonshire and Rutland REC06/Q2501/122) and patients’ consent were obtained through the Haematological Tissue Bank of the Ernest and Helen Scott Haematological Research Institute, Leicester, UK. Peripheral blood mononuclear cells were isolated from the blood of patients presenting in leukemic phase and the CellTiterGlo assay (Promega, Mannheim, Germany) was used to assess these cells’ viability.
Western blotting and immunoprecipitation
For western blotting, proteins were obtained using Tris-lysis buffer containing 1% TritonX. Western blotting was performed using the following antibodies: mouse anti-BCL-2 (M088701-2, Dako Agilent, Hamburg, Germany), rabbit anti-BCL-XL (2762S, Cell Signaling, Beverly, MA, USA), rabbit anti-MCL-1 (ADI- AAP-240F, Enzo, Farmindale, NY, USA), rabbit anti-BIM (3183S, Cell Signaling), mouse anti-NOXA (ALX-804-408, Enzo), rabbit anti-BAK (06-536, Upstate/Merck), mouse anti-BAX (2772S, Cell Signaling) and mouse anti-GAPDH (5G4-6C5, BioTrend, Hy Test Ltd., Turku, Finland). Immunoprecipitation was per- formed using the following antibodies: hamster anti-BCL-2 ( 551051, BD Bioscience, Heidelberg, Germany), rabbit anti-BCL- XL (ab32370, Abcam), rabbit anti-MCL-1 (ADI-AAP-240F, Enzo), mouse anti-BAX (610983, BD Bioscience), and rabbit anti-BAK (ab32371, Abcam). Antibodies were crosslinked to protein G dynabeads (Invitrogen, Karlsruhe, Germany). CHAPS containing lysates were incubated overnight at 4°C with the antibody-pro- tein G complexes before the precipitates were washed in lysis buffer and analyzed by western blotting .
BH3-profiling
Cells were gently permeabilized with 0.0025% digitonin before exposure to 0.1, 1 or 10 mM of synthetic peptides (BIM, BAD, XXa1_Y4eK18). Loss of mitochondrial membrane potential was measured using 1 mM JC-1 via a Hidex Sense plate reader as described previously.19 Results were normalized to those of dimethylsulfoxide (DMSO) and carbonyl cyanide-4-(trifluo- romethoxy)phenylhydrazone (FCCP) controls.
Geneticmodifications
For silencing of individual genes, cells were electroporated with a neon transfection system (ThermoFisher) using two puls- es of 20 ms at 1200 V. The following silencer select short inter- fering (si)RNA (ThermoFisher) were used at 100 nM: BAX (#1s1888, #3s1890), BAK (#1s1880, #2s1881), BIM (#1s195011, #2s195012, #3s223065), BCL-XL (s1921), MCL-1 (s8583), and NOXA (s10709, s10710). CRISPR/Cas9 engineering was done as described previously.20 Briefly, three guide (g)RNA against human BAK (GGTAGACGTGTAGGGCCAGA, TCACCTGC- TAGGTTGCAG, AAGACCCTTACCAGAAGCAG) or against green fluorescent protein as a non-human target (NHT) (GGAGCGCACCATCTTCTTCA, GCCACAAGTTCAGCGT- GTC, GGGCGAGGAGCTGTTCACCG) were cloned in pLentiCRISPRv2 (Addgene # 52961). Lentiviral particles were generated by co-transfecting pLenti-CRISPRv2 NHT and BAK with pPAX2 (Addgene # 12260) and pMD2.G (Addgene # 12259) in HEK293T cells and used to transduce U2946 or SUDHL8 tar- get cells using spin transduction followed by puromycin selec- tion and isolation of BAK-deleted single clones using limited dilution. The BAK expression status was assessed using western blotting.
haematologica | 2020; 105(8)
2151