Page 34 - Haematologica August 2018

1270
P. Shyamsunder et al.
Identification of novel targets of CEBPE is imperative for a better understanding of granulocytic differentiation. In this study, we utilized ChIP-seq and RNA-seq data, the former to identify global DNA binding pattern of CEBPE and the latter to note expression changes of CEBPE defi- cient cells. Together, these techniques allowed identifica- tion of novel targets of CEBPE associated with myelopoe- sis.
One of the interesting targets of CEBPE that we identi- fied in this analysis is Card10 (also called Carma3). The CARMA family has three members, CARMA1, CARMA2, and CARMA3. They contain a N-terminal CARD domain, followed by a coiled-coil domain (C-C), a PDZ domain, a SH3 domain, and a Guanylate Kinase-like (GUK) domain in the C-terminus. Although the CARMA proteins share a high degree of sequence similarity, they display a distinct tissue expression pattern.18 A study by Xin Lin et al., analysed microarray data of 353 human tis- sue samples and found that CARMA1 is primarily expressed in hematopoietic tissues such as spleen, thy- mus, and peripheral blood leukocytes. Expression of CARMA2 is specific to placenta, and CARMA3 (CARD10) is expressed in a wide range of tissues with modest expression detected in hematopoietic cells.19 CARD10 has been described as a molecular link between G protein- coupled receptors and NF-κB. GPCR induced ubiquitina- tion of IKK-γ (NEMO) with concomitant activation of the IKK complex is completely defective in CARD10 deficient cells.18 Studies have demonstrated that CARD10 deficient murine embryonic fibroblasts have diminished lysophos- phatidic acid (LPA) induced NF-κB activation and lowered IL-8 production.18 Similarly, inhibition of CARD10 in airway epithelial cells reduces LPA-mediated NF-κB activity and the secretion of NF-κB dependent cytokines, TSLP and CCL20, thus pointing to a role for CARD10 in initiating allergic inflammation.20
In the present study, we show that Card10 is a direct tar- get of CEBPE. We verify that CEBPE binds to a region upstream of Card10 gene and its expression is upregulated in the granulocytic population. We demonstrate that knock-down of Card10 in a human cell line and in murine progenitor cells causes a defect in granulocytic differentia- tion. Expression analysis of Card10 depleted murine pro- genitor cells revealed that knock-down of Card10 affected expression of key genes involved in granulopoiesis. Taken together, we identify Card10 as a novel target of CEBPE with a role in myeloid cell differentiation and function.
Methods
Mice
CEBPE knock out (KO) mice have been described previously.9 Mice were maintained on a C57BL/6J (B6) genetic background at the animal facility of Comparative Medicine Centre, National University of Singapore (NUS). CEBPE KO allele was genotyped using primers: GCTACAATCCCCTGCAGTCC, TGCCTTCT- GCCCTTGTG and ATCGCCTTCTATCGCCTTCTTGACGAG. All mice experiments were approved by Institutional Animal Care and Use Committee, NUS, Singapore.
Flow cytometry
Single cell suspensions were incubated with fluorochrome-con- jugated antibodies for 30 min on ice. Cells were washed with 2% FBS/PBS and resuspended in SYTOX Blue Dead Cell Stain
(ThermoFisher Scientific). Flow cytometric analysis was per- formed on FACS LSR II flow cytometer (BD Biosciences), and sort- ing of cells was performed on FACS Aria cell sorter (BD Biosciences). Data were analyzed using FACSDIVA software (BD Biosciences).
ChIP-PCR
DNA-protein complexes were cross-linked with 1% formalde- hyde at room temperature for 10 min, followed by quenching with 0.2 M glycine for 5 min. Cells were lysed and chromatin was sonicated in Lysis buffer (1% SDS, 50 mM Tris-HCl, 5mM EDTA) at 4°C using Diagenode Bioruptor. Sheared-sonicated chromatin was incubated overnight at 4°C with antibodies against Cebpe and a mixture of Dynabeads Protein A and Protein G (1:1). Bead-chro- matin complexes were washed, and the chromatin was eluted in 1% SDS, 0.1M sodium bicarbonate and reverse-crosslinked at 65°C for 16 hours. Immunoprecipitated DNA was extracted using QIAquick PCR Purification Kit (Qiagen) and quantified using Qubit Fluorometer (Life Technologies). Input and immunoprecip- itated DNA were amplified using three different primer pairs. Primer sequences used for ChIP-PCR can be found in Online Supplementary Table S4.
Electrophoretic mobility shift assay
293T cells were transfected with either 1 μg pcDNA3.1(-) empty vector or Cebpe expressing vector in 100 mm dishes using Jetprime transfection reagent (Polypus) according to manufactur- er’s instructions. After transfection, cells were cultured for 48 hours, and nuclear extracts were prepared using NE-PER reagent (Thermo Scientific). Double-stranded oligonucleotide probes were labelled using 3’ Biotin End labelling kit (Thermo Scientific) fol- lowing the manufacturer’s instructions. Following biotinylated probes were used: CEBP consensus (5’-GATCCATATCCCT- GATTGCGCAATAGGCTCAAAA); Card10 (5'- GAATGAGCC- GATTGCTGCAACCTGGAAGG); Mutant Card10 (5'- GAAT- GAGCCGGCCTTGGGGCCCTGGAAGG) along with 100 fold molar excess of corresponding cold competitor. EMSA was carried out using LightShift Chemiluminescent EMSA Kit (Thermo Scientific). DNA-protein complexes were resolved on native 10% polyacrylamide–TBE gels.
Luciferase reporter assay
A 500 bp fragment upstream of Card10 gene (encompassing the CEBPE binding site identified in ChIP-seq) was amplified from genomic DNA extracted from murine bone marrow cells and sub- cloned into pGL4-Basic vector (Promega, Madison, WI). NIH/3T3 cells were transfected with pCDNA-Cebpe along with either pGL4 basic vector or pGL4-Card10 vector (-7kb peak) using Lipofectamine Plus (Life Technologies). Renilla basic vector was co-transfected as a control for normalization of luciferase activity; luciferase was measured 24 hours after transfection using Promega Dual-Glo assay kit, as per the manufacturer’s instructions.
Isolation, culture and differentiation of Lin–Kit+ bone marrow cells
Murine Lin–Kit+ cells were isolated from the bone marrow of C57BL/6 mice. Briefly, bone marrow cells were flushed from femurs and tibias using PBS containing 5%FBS; red cells were lysed and anti-rat IgG Dynabeads (Invitrogen) were used to deplete lineage +ve cells. Lin–Kit+ cells were sorted on FACS Aria (BD Biosciences). Sorted cells were cultured in the presence of IL3, IL6 and SCF. To induce granulocytic differentiation, 10 ng/mL GM-CSF was added to the culture medium. Granulocytic differ- entiation was monitored using flow cytometry at days 3, 5 and 7 of GM-CSF treatment.
haematologica | 2018; 103(8)