Page 65 - Haematologica May 2022

Defective eNOS and angiogenesis in GATA2 R398W
been reported in patients with GATA2 deficiency, and among these thrombosis appears to be a rather frequent occurrence.2,8,9 Different types of thrombotic events have been reported, ranging from atherothrombotic or embolic stroke to recurrent venous thromboembolism (VTE), reti- nal vein thrombosis or catheter-related thrombosis, amounting to 25% of patients with GATA2 deficiency suffering thrombotic episodes, half of whom with multi- ple events.2,8,10,11 The reason of the high incidence of thrombosis in GATA2 deficiency is unknown, but it has been suggested to be multi-factorial since patients carry- ing GATA2 variants often have thrombotic risk factors, including infection, malignancy, bone marrow transplan- tation and central venous catheters.2 GATA2 is involved in vascular development12,13 and the knockdown of GATA2 in human endothelial cells led to vascular abnor- malities,14 suggesting a role of endothelial rather than coagulation abnormalities in the pathogenesis of throm- bosis associated with GATA2 deficiency. Interestingly, GATA2 was found to act as a promoter of the endothelial nitric oxide synthase gene (eNOS), the enzyme producing nitric oxide (NO), in bovine aortic endothelial cells and in the airway epithelium.15,16 NO plays a crucial role in the cardiovascular system acting as a powerful antithrombot- ic agent through its vaso-dilatatory, platelet inhibitory and anti atherosclerotic activities17-19 and recent data show that its deficiency is associated with enhanced risk of VTE too.20,21 However, no studies so far have explored NO production in patients with GATA2 deficiency.
Here we show for the first time that platelets and endothelial cells from patients with GATA2 deficiency due to the R398W GATA2 variant exhibit impaired NO production and defective angiogenesis which can largely be corrected by pharmacologically-induced recovery of e- NOS mRNA expression.
Methods
Germline GATA2 mutation patients
The proband (II2) was a 22 years old girl with mild anemia,
reduction of monocytes, B and NK cells, recurrent otitis and papilloma virus infections, compatible with the MonoMac syn- drome.4 Her mother (I1, 65 years old) and her sister (II1, 30 years old) did not show any clinical phenotype, and her father (I2, 66 years old) had a past clinical history of stroke and venous throm- bosis. The father had suffered a first ischemic stroke at the age of 59, with no evidence of a cardioembolic source, and a recur- rent ischemic stroke at the age of 66 while on aspirin. He later developed an unprovoked subclavian vein thrombosis and was then put under permanent oral anticoagulation with a direct oral anti-Xa drug. A thorough assessment for inherited or acquired thrombophilic conditions was negative.
The study was approved by Comitato Universitario di Bioetica, University of Perugia (date of approval: 01/07/2019; approval number: 2019-21). The study was conducted according to the Declaration of Helsinki. Informed consent was obtained from the proband and all family members.
Blood outgrowth endothelial cells
Blood outgrowth endothelial cells (BOEC) were isolated from peripheral blood of the proband and her family and from age- and sex-matched healthy controls and cultured as previ- ously described.22,23 For details see the Online Supplementary Appendix.
Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChiP) assay was performed using the SimpleChiP® enzymatic Chromatin IP Kit #9002 (Cell Signaling, Danver, MA, USA), according to the manufacturer’s instructions.24,25 Purified DNA was used as template for quantita- tive polymerase chain reaction (qPCR), using primers amplifying the eNOS promoter regions that are recognized by the AP-1 (for- ward: CTCAGCCCTAGTCTCTCTGC; revere: GGTTCTTGGGGATAGAGGCC) and GATA2 (forward: GGT- GCCACATCACAGAAGGA; reverse: CACAATGGGACAGGAACAAGC) transcription factors, as previously described15. For details see the Online Supplemental Appendix.
Protein expression: western blotting
Proteins were extracted from BOEC, quantified using the Bradford method, and Western blotting was carried out as described.26,27 For details see the Online Supplementary Appendix.
Immunofluorescence analysis of GATA2
GATA2 distribution was evaluated by immunofluorescence analysis with confocal microscopy, as previously described.28 For details see the Online Supplementary Appendix.
Nitric oxide production
NO generation in BOEC and platelets was studied by flow cytometry using a specific fluorescent probe (4-amino-5-methy- lamino-2’,7’-Difluorofluorescein diacetate, DAF-FM diacetate, Invitrogen). BOEC were stimulated with acetylcholine 10 μM or acetylcholine 10 μM plus N5-(1-Iminoethyl)-L-ornithine dihy- drochloride (L-NIO), a NOS inhibitor29 100 μM. Platelets were stimulated with type I collagen (Mascia Brunelli, Milan, Italy) at increasing concentrations (1-10 μg/mL) and NO-generated fluo- rescence was analyzed as previously described.30 For details see the Online Supplementary Appendix.
eNOS activity assay
eNOS activity was measured by assessing the enzymatic con- version of (H3)L-arginine to (H3)L-citrulline. A standard curve with increasing (H3)L-arginine concentrations was built for each assay.31 For details see the Online Supplementary Appendix.
Treatment of blood outgrowth endothelial cells with eNOS inducers
BOEC from healthy controls and from GATA2-deficient patients at passage 5 were seeded in 24-well plates (150×103 cells/well) in serum-free EBM2 medium. Cells were incubated with atorvastatin at a concentration of 50 μM,32 or with resvera- trol 40 μM,33 or with their vehicle (dimethyl sulfoxide [DMSO]) for 24 hours (h) in serum-free medium. DMSO final concentra- tion never exceeded 0.5%.
In vitro Matrigel angiogenesis assay
Angiogenesis was estimated by measuring total tube length
and by counting tubule number and branching points, as previ- ously described.34 For details see the Online Supplementary Appendix.
Statistical analysis
Data are presented as means ± standard error of the mean. The t-test for unpaired data was used to analyze results with a significant difference set at P<0.05. For details see the Online Supplementary Appendix.
Further details on materials and methods are available in the
Online Supplementary Appendix.
haematologica | 2022; 107(5)
1073