Page 189 - 2022_03-Haematologica-web
P. 189
Letters to the Editor
AB
CDE
FG
Figure 1. Enhancement of osteoclastogenesis and multiple myeloma tumor growth by immobilization. SCID mice were subject to sham-operation (control), sci- atic denervation (DN) or casting with adhesive bandages (CAST) of the right hind legs. Two weeks later, the right tibiae were taken out, and histomorphometrically analyzed. (A) Micro-computed tomography (mCT) image of the representative tibiae resected from each treatment group. (B) Tibiae were resected from mice, carefully separated from surrounding tissues, and fixed overnight in 10 % formaldehyde solution. The dissected tibiae were then examined with a SkyScan 1176 unit (SkyScan 1176 scanner and analytical software; Buruker, Billerica, MA) using a 0.5 mm aluminum filter, rotation of 360°, rotation step of 0.5°, voltage of 50 kV, current of 200 mA and image size of 18 mm voxel size. The regions of interest for trabecular bones analyzed with a mCT were set on a 1.5 mm region of metaphyseal spongiosa in the proximal tibia located 0.5 mm above the growth plate. The threshold was set with 93 (lower) and 255 (upper), which was able to clearly indicate the trabecular bone. Bone volume over total volume (BV/TV), trabecular thickness (Tb.Th), trabecular numbers (Tb.N) and trabecular separation (Tb.Sp) were assessed in trabecular bones. Data are expressed as the mean ± standard deviation (SD) (n=6). (C) TRAP staining was performed in the sections of the resected tibiae using a TRAP/ALP stain kit (FUJIFILM Wako Chemicals USA, Richmond, VA, USA). TRAP-positive cells containing 3 or more nuclei on the bone surface were counted as osteoclasts (OC) under a light microscope (BZ-X800; Keyence, Osaka, Japan). Three fields were counted for each sample. Representative results were shown (magnification, ×100) (upper). Bars: 200 mm. Higher magnification (×400) of the boxed areas in the upper panels were shown in the lower panels. Bars: 50 mm. (D) Numbers of osteoclasts (N.Oc)/bone surface (BS) (/mm) were counted. Data are expressed as the mean ± SD (n=6). *P<0.05. (E) Serum levels of TRAP-5b (mg/mL), ALP (mU/mL) and Gla-osteocalcin (OCN) (ng/mL) were measured 2 weeks after the sciatic denervation (DN). In order to measure the serum levels of bone metabolic parameters, Mouse Osteocalcin EIA Kit (Biomedical Technologies Inc., MA, USA), Mouse TRAP-5b Assay (Immuno diagnostic system Ltd, UK), and alkaline phosphatase (ALP) test kit (Wako, Osaka, Japan) were used in accordance with the manufactures’ pro- tocols. Data are expressed as the mean ± SD (n=6). *P<0.05. (F) Femurs were taken out at 2 weeks after the immobilization, and their bone marrow cavities were flushed out. Expression of RANKL, SOST, and OPG mRNA were analyzed by real-time reverse transcription polymerase chain reaction (RT-PCR) using the femurs. The primer sequences were as follows: mouse Rankl F: GTTCCTGTACTTTCGAGCGCAGAT, R: TGACTTTATGGGAACCCGATGGGA mouse Opg F: TTGCCCTGAC- CACCACTCTTATACGGA, R: CTTTTGCGTGGCTTCTCTCTGTTTCC mouse SOST F: TCCTCCTGAGAACAACCAGAC, R: TGTCAGGAAGCGGGTAGTC mouse Gapdh F: ATGTGTC- CGTCGTGGATCTGA, R: TTGAAGTCGCAGGAGACAACCT. Serum level of RANKL (pg/mL) were measured by Mouse TRANCE/RANKL/TNFSF11 ELISA kit (R&D sys- tems). Data are expressed as the mean ± SD (n=6). *P<0.05. (G) Luciferase-transfected 5TGM1 (5TGM1/luc) multiple myeloma (MM) cells were inoculated into tibiae 2 weeks after DN or sham operation. Two weeks after the immobilization, we injected 1x105 5TGM1/luc MM cells in 20μL saline, and directly through the tibial plateau into the bone marrow cavity of the tibiae with a 27-gauge needle while flexing the knee. IVIS images were taken 2 and 4 weeks after the inoc- ulation. Tumor areas with luminescence shown in green, yellow and red were measured. Px: pixel. Data are expressed as the mean ± SD (n=3). *P<0.05.
haematologica | 2022; 107(3)
745

