Page 62 - 2022_02-Haematologica-web

R. Birsen et al.
Methods
Cell lines and reagents
HL60, MOLM14, SET2, MV4-11, OCI-AML2, OCI-AML3, K562, THP1, UT7-EPO, SKM1, NB4 and KASUMI AML cell lines were used. Patients provided written informed consent in accordance with the Declaration of Helsinki. Bone marrow (BM) samples were obtained from five patients with newly diagnosed AML (characteristics provided in the Online Supplementary Table S1). Cells were cultured in RPMI with glutamine (Gibco61870, Life Technologies® Saint Aubin, France) supplemented with 10% fetal bovine serum (FBS) and 4 mM glutamine. All AML cell lines were certified using their microsatellite identity (character- istics provided in Online Supplementary Table S2). Ferrostatin-1, necrostatin-1, necrostatin-1S, necrosulfonamide, QVD-OPH, APR-246 for the in vitro study, erastin and RSL3 were sourced from Selleckchem (Houston, TX). Chloroquine and doxycycline were obtained from Sigma–Aldrich (Saint-Louis, MO). FINO2 was purchased from Cayman Chemicals (Ann Arbor, MI). The APR-246 reagent used in the in vivo study was provided by APREA therapeutics (Solna, Sweden).
Constructs
Inducible short hairpin RNA (shRNA) targeting SLC7A11 or GPX4 were constructed as previously described17 using the fol- lowing sequences: SLC7A11#2, GCTGAATTGGGAACAAC- TATA; SLC7A11#3, GCAGTTGCTGGGCTGATTTAT; GPX4#1, GTGAGGCAAGACCGAAGTAAA; GPX4#2, CTA- CAACGTCAAATTCGATAT.
Lentivirus production and acute myeloid leukemia cell line infection
293-T packaging cells were used to produce lentiviral constructs through co-transfection with plasmids encoding lentiviral pro- teins. Supernatants were collected and ultracentrifuged for 48 hours (h) after transfection over two consecutive days and subse- quently stored at -80°C. AML cell lines were plated at 2x106/mL and 2-10 mL aliquots of lentiviral supernatants were added for 3 h. Cells were then grown in 10% fetal calf serum medium and fur- ther selected with puromycin. For shRNA induction, 200 mg/mL doxycycline was added to the culture medium.
Flow cytometry-based assay
Data acquisition and data analysis were conducted at the Cochin Cytometry and Immunobiology Facility. For glutathione measurements using monochlorobimane (MCB; Thermofischer; Waltham, MA), 2x105 cells were labeled with 40 mM MCB in 1 mL of warm complete medium for 20 minutes (min) in a tissue culture incubator (37°C, 5% CO2) in the dark. The reaction was terminated using 1 mL of cold complete medium, followed by centrifugation (200xg, 1 min). The pelleted cells were then re- suspended in 0.5 mL of cold complete medium and placed on ice in the dark until analysis by flow cytometry (FCM). The MCB- GSH signal was detected using a 355 nm laser through a 450/50 nm filter. FCM data were collected using a BD Fortessa flow cytometer with DIVA software. 10,000 events were recorded for analysis. Data analysis was then carried out with KALUZA soft- ware. For lipid peroxide production measurements using C11- BODIPY (581/591) (2 mM) (Thermofischer, Waltham, MA), 2x105 cells were labeled with C11-BODIPY in 1 mL of warm complete medium for 10 min in a tissue culture incubator (37°C, 5% CO2) in the dark. Cells were then washed twice and resus- pended in 200 mL of fresh PBS. For cystine uptake measurements using BioTracker Cystine-FITC Live Cell Dye (5 mM) (Thermofischer, Waltham, MA), 2x105 cells were labeled with
Biotracker cystine in 1 mL of warm complete medium for 120 minutes in a tissue culture incubator (37°C, 5% CO2) in the dark. FCM data were collected using a C6 Accuri flow cytometer (Becton Dickinson, Le Pont de Claix, France) with CFlow Plus software. 10,000 events were captured for subsequent analysis with CFlow Plus software (Becton Dickinson, Le Pont de Claix, France).
Western blotting
Whole-cell extraction and western blotting were performed as previously described.17 Anti-GPX4 antibody was purchased from Proteintech (Manchester, UK). Anti-PARP, caspase 8, cas- pase 3, cleaved caspase 3, MLKL, pMLKL, p53 and SLC7A11 antibodies were sourced from Cell Signaling Technology (Danvers, MA, USA).
Viability assay
AML cells were plated at 20x104/mL in 100 μl of 10% FBS- supplemented RPMI prior to the addition of compounds. Cells were cultured in the presence of the test compounds for 24 to 48 h at 37°C. Viability was quantified using the fluorescence based Uptiblue assay (Interchim, Montluçon, France). Uptiblue was added to each well in 10 mL aliquots. Fluorescence was then measured with a Typhoon FLA9500 scanner (GE Healthcare; IL). Fluorescence values were normalized to dimethyl sulfoxide (DMSO)-treated controls for each AML cell line. Half maximal inhibitory concentration (IC50) values were calculated using a four parameter non-linear regression curve with Graph Pad Prism v8 (GraphPad, La Jolla, CA, USA). For primary AML cells, viability was assayed by FCM analysis using forward scatter (FSC) versus side scatter (SSC).
Measurement of synergistic effects
Cell viability was calculated for every dose combination of APR-246 and ferroptosis inducer using the Synergy Finder webtool (https://synergyfinder.fimm.fi/) and compared to each agent alone. Calculations were based on the ZIP model.18
Tumor xenografts in NOD/SCID IL-2 receptor
g-chain-null mice
Xenograft tumors were generated by randomly injecting
1×106 MOLM14 shCTRL or shSLC7A11 cells into the tail veins of NOD/SCID IL-2 receptor g-chain-null mice (NSG) aged 6–9 weeks. Fourteen days after injection, doxycycline (200 mg/mL) and sucrose (1% weight:volume) were added to the drinking water of these animals. After 3 days, the mice were randomly treated with a daily intraperitoneal injection of APR-246 (100 mg/kg) or vehicle (phosphate-buffered saline [PBS]) for 4 days. All experiments were conducted in accordance with the guide- lines of the Association for Assessment and Accreditation of Laboratory Animal Care International. Animals were used in accordance with a protocol reviewed and approved by the Institutional Animal Care and Use Committee of Région Midi- Pyrénées (France). BM (mixed from tibias and femurs) were dis- sected and flushed in Hanks balanced salt solution with 1% FBS. MNC from BM were labeled with PE-conjugated anti-hCD33, PerCP-Cy5.5-conjugated anti-mCD45.1 and APC-conjugated anti-hCD45 (all antibodies from Becton Dickinson, BD) to deter- mine the fraction of human blasts (hCD45+mCD45.1−hCD33+ cells) using FCM. Acquisition of data was performed on a CytoFLEX (Beckman Coulter) flow cytometer with CytExpert software. The number of AML cells in the BM was determined using CountBright beads (Invitrogen, CA, USA) in accordance with the manufacturer’s protocol. Data analysis was performed with flowJo software.
404
haematologica | 2022; 107(2)