Page 71 - 2021_12-Haematologica-web

RA/arsenic activate a PML/P53 axis in NPM-1c AML
and overall survival,13 a United Kingdom Medical Research Council trial failed to demonstrate any overall advantage of adding RA to chemotherapy.14,15
Intriguingly, the potential benefit of RA co-administration with chemotherapy seems restricted to patients bearing an NPM-1c mutation in the absence of an fms-like tyrosine kinase 3 (FLT3)-internal tandem duplication (ITD).16 Whether this efficacy reflects RA-induced AML differentia- tion, as observed in several non-APL AML primary patients’ cells or models,11,12 remains to be elucidated. Interestingly, NPM-1c is degraded upon administration of RA, suggesting that loss of NPM-1c expression may underlie, or at least contribute to, RA-driven differentiation and apoptosis ex vivo.17,18 Ex vivo, NPM-1c degradation was accelerated by co- administration of arsenic trioxide (ATO) which, like RA, may inhibit Pin1, a protein-modifying enzyme implicated in growth control through multiple mechanisms.5,6,19 The actual mechanism of RA-induced enhancement of the response to chemotherapy in NPM-1c- AML remains to be elucidated.
PML (TRIM19) nucleates nuclear bodies, which are stress-responsive domains that have growth suppressive properties.20 In vivo, PML nuclear bodies are oxidative stress sensors that control P53 activation.21 PML plays a key role in the therapeutic response of APL.9,22-25 The expression of PML is altered in multiple tumor types, most often through PML protein loss upon activation of several degradation pathways, including Pin1.26-30 Interestingly, we previously reported impairment of PML nuclear body formation in NPM-1c-driven AML.17,18
Here, we unravel an unexpected role of PML in RA-initi- ated responses of NPM-1c AML cells. PML is required to initiate RA-driven NPM-1c degradation, P53 activation and cell death. Mechanistically, RA stabilizes PML through inhi- bition of overexpressed and activated Pin1, enforcing growth arrest. Such RA-induced activation of the PML/P53 signaling cascade enhances the activity of chemotherapy or arsenic in vivo. Our studies identify PML as an unsuspected actor downstream of RA in NPM-1c AML.
Methods
Cell lines and treatments
OCI-AML3 or OCI-AML2 AML cells (harboring the NPM-1c mutation without FLT3-ITD or wild type [wt] NPM-1 respective- ly) were grown in minimum essential medium-α (MEM-α) sup- plemented with 20% fetal bovine serum (FBS) and antibiotics. Cells were seeded at the density of 2x105/mL.
RA (Sigma Aldrish) was used at a final concentration of 1 mM. The Pin1 inhibitor AG17724 (Sigma Aldrish) was used at 20 mM. Doxorubicin (Ebewe Pharma) and cytarabine (AraC) (Alexan, Ebewe Pharma) were each used at a final concentration of 1 mM. Cell growth was assessed using the trypan blue dye assay.
Patients’ cells
Primary bone marrow blasts from AML patients were extracted following Ficoll separation and cultured in MEM-α supplemented with 20% FBS and antibiotics. Patients’ samples were collected following approval by the American University of Beirut Institutional Review Board and after patients had provided written informed consent in accordance with the Declaration of Helsinki. The patients’ characteristics are summarized in Online Supplementary Table S1.
Two AML patients with NPM-1c mutations who were judged
unfit for conventional chemotherapy received off-label compas- sionate RA (25 mg/m2 daily) and ATO (0.15 mg/kg daily) after informed consent.
CRISPR OCI-AML3 cell lines
PML expression was abrogated by CRISPR-mediated excision. A guide RNA targeting PML (forward: 5’-GTCGGTGTACCG- GCAGATTG; reverse: 5’-AATCTGCCGGTACACCGAC) was designed and cloned into pLAS5w.Ppuro-Cas9 plasmid for viral packaging. OCI-AML3 cells were infected with the corresponding viruses. Stable selection of knock-out cells was performed in the presence of 1 mg/mL puromycin, over a period of 2 weeks. Three OCI-AML3pml-/- clones were generated and tested in this study. Similarly, P53 extinction was performed using a guide RNA target- ing P53 (forward: 5’-CCATTGTTCAATATCGTCCG; reverse: 5’- CGGACGATATTGAACAATGG). Recombinant Cas9 protein was synthesized from IDT to form Alt-R CRISPR/Cas9 RNP. OCI- AML3 cells were transiently transfected with Alt-R CRISPR/Cas9 RNP by using Nucleofector kit T (Amaxa) and applied program number X-01 in the nucleofactor device (Lonza). The stable CRISPR knock-out clones were cloned by serial dilution to gener- ate a single-cell separation. DNA from individual clones was extracted and the region surrounding the Cas9 cutting site was amplified by polymerase chain reaction and verified by sequenc- ing to ensure the deletion of the target genes. Two OCI-AML3P53-/- clones were generated and tested in this study.
Pin1 knock-down was perfomed using all-in-one plasmid pLAS5w.Ppuro-Cas9-gPin1 Pin1 (CCACCGTCACACAGTATT- TAT). Lentiviruses were produced by transient transfection of HEK-293T cells. OCI-AML3 cells were infected by spinoculation for 90 min at 28,000 rpm at 32°C. Stable selection of knock-out cells was performed in the presence of 1 mg/mL puromycin. Single cells were sorted in 96-well plate to have stable clones. Knock-out stable clones were verified by immunofluorescence and western blot using a polyclonal anti-Pin1 antibody (Cell Signaling).
Statistical analysis
Data are reported as means ± standard deviations. Statistical analysis was done using a Student t-test, P-values <0.05 are con- sidered statistically significant.
Other methods
Immunoblotting, RNA isolation and quantitative reverse tran- scriptase polymerase chain reaction, microarray analysis and gene set enrichment analysis, immunofluorescence and confocal microscopy, Pin1 activity assay, colony formation assay, xenograft animal studies, human CD45 staining and cell sorting are described in the Online Supplementary Methods.
Results
PML-dependent NPM-1c degradation activates P53
We and others demonstrated that RA triggers NPM-1c degradation, P53 activation, apoptosis and induces PML nuclear body formation in NPM-1c-expressing AML cell lines.17,18 Since PML nuclear bodies may be implicated in therapy-induced catabolism of other oncoproteins,34 we were prompted to investigate any role of PML in RA-trig- gered NPM-1c degradation. We thus generated CRISPR PML OCI-AML3 cell lines (Figure 1A, Online Supplementary Figure S1A). In these OCI-AML3pml-/- cells, RA-mediated NPM-1c degradation was blocked (Figure 1A, Online Supplementary Figure S1A) and RA-induced cell death was abrogated (Figure 1B, Online Supplementary Figure S1B).
haematologica | 2021; 106(12)
3091