Page 180 - 2021_10-Haematologica-web

S. El Hoss et al.
lassemia patients. In contrast, a marked decrease in the life span of circulating red cells, a feature of sickle red cells, is considered to be the major determinant of chronic anemia in SCD. It is generally surmised that ineffective erythropoiesis contributes little to anemia. There have been, however, a number of sporadic reports that suggest defective terminal erythroid differentiation in SCD. For example, erythroblasts differentiated in vitro or isolated from bone marrow of SCD patients were shown to sickle under hypoxic conditions.7 Such sickling was also report- ed in the SAD mouse model, with altered morphology of late stage erythroid precursors within the bone marrow, as well as high levels of hemoglobin polymers and increased cell fragmentation occurring during medullary endothelial migration of reticulocytes.8 It was presumed that sickling of erythroblasts could lead to ineffective ter- minal erythroid differentiation. The study of Wu et al. showed for the first time evidence of ineffective erythro- poiesis occurring in the bone marrow of transplanted SCD patients with the preferential survival of the donor erythroid cells in a small cohort of patients.9
In the present study, we performed a detailed character- ization of terminal erythroid differentiation in non-trans- planted SCD patients using both in vivo and in vitro assay systems to critically assess the extent of ineffective ery- thropoiesis. We documented in both our in vivo and in vitro studies, the occurrence of ineffective erythropoiesis at late stages of terminal erythroid differentiation reflected by high cell death rates between the polychromatic and the orthochromatic stages. We explored the potential mechanistic basis for ineffective erythropoiesis in SCD patients and showed that the molecular mechanism responsible for cell death is likely related to HbS polymer- ization and its interaction with chaperone protein HSP70 leading to its cytoplasmic sequestration. Importantly, we documented that increased expression of fetal hemoglo- bin (HbF) can rescue differentiating erythroblasts from cell death.
Methods
Biological samples
The study was conducted according to the declaration of Helsinki with approval from the Medical Ethics Committee (GR-Ex/CPP-DC2016-2618/CNILMR01). All SCD patients were of SS genotype. Blood bags from SCD patients enrolled in an exchange transfusion program, bone marrow aspirates from five SCD patients undergoing surgery and bone marrow tissues from five non-anemic donors undergoing hip/sternum surgery, were obtained after informed consent, from Necker-Enfants Malades Hospital (Paris, France) and the North Shore-LIJ Health System (New York, USA) under Institutional Review Board (IRB) approval. Control blood bags from healthy donors were obtained from the Etablissement Français du Sang (EFS).
In vitro differentiation of human erythroid progenitors Peripheral blood mononuclear cells were isolated from blood samples after Pancoll fractionation (PAN Biotech). CD34+ cells were then isolated by a magnetic sorting system (Miltenyi Biotec CD34 Progenitor cell isolation kit) following the supplier protocol. CD34+ cells were placed in an in vitro two-phase liquid culture system, as previously described.10 For detailed protocols
please refer to the Online Supplementary Appendix.
For cultures treated with pomalidomide, cells were incubated
with 1 mM pomalidomide (Sigma) as previously described,11 starting from day 1 (D1) of phase II of culture. For γ-globin dere- pression experiments using CRISPR/Cas9, patient CD34+ cells were immunoselected and cultured for 48 hours (h) and then electroporated with ribonucleoprotein (RNP) complexes con- taining Cas9-GFP protein (4.5 mM) and the -197 guide RNA (gRNA) targeting both HBG1 and HBG2 γ-globin promoters (5’ ATTGAGATAGTGTGGGGAAGGGG 3’; protospacer adjacent motif in bold) or a gRNA targeting the Adeno-associated virus integration site 1 (AAVS1; 5’ GGGGCCAC- TAGGGACAGGATTGG 3’; protospacer adjacent motif in bold).12 Cleavage efficiency was evaluated in cells harvested 6 days after electroporation by Sanger sequencing followed by tracking of indels by decomposition (TIDE) analysis.13
Imaging flow cytometry analysis of human bone marrow samples
Bone marrow samples were processed as previously described.14 Detailed protocol are stated in the Online Supplemental Appendix.
Flow cytometry
Cells were analyzed using a BD FACScanto II flow cytometer and BD LSR Fortessa SORP flow cytometer (BD Biosciences) and acquired using the Diva software version 8 (BD Biosciences). Data was analyzed using FCS Express 6 software (DeNovo Software). Detailed protocols of cell staining are stated in the Online Supplemental Appendix.
Cell fractionation and western-blot
Cytoplasmic and nuclear protein fractions were extracted from erythroblasts at D7 of phase II of culture using the NE-PER nuclear and cytoplasmic kit (Pierce-Thermo Scientific). Ten μg of nuclear and cytoplasmic proteins were analyzed by SDS-PAGE, using 10% polyacrylamide gels, followed by immunoblotting. The antibodies used were rabbit anti-HSP70, mouse anti-actin and mouse anti-lamin A/C as a control for the nuclear extract. Proteins were revealed using electrochemiluminescence (ECL) clarity (Biorad) and the Chemidoc MP imaging system (Biorad). Analysis was performed using Image Lab (Biorad). Antibodies details are stated in the Online Supplemental Appendix.
Co-immunoprecipitation assays
Co-immunoprecipitation of HSP70 and hemoglobin was per- formed with lysates of 10 million RBC from SCD patients that were either exposed to hypoxia or not for one hour. HSP70 was immunoprecipitated by incubating the lysates with mouse anti- HSP70 antibody (Enzo Lifesciences) overnight at 4°C followed by a 45-minute incubation with protein-G sepharose beads (Cytiva-GE-Healthcare) at 4°C. Eluted proteins were analyzed by SDS-PAGE using a 4-12% polyacrylamide gel, followed by immunoblotting with mouse anti-α-globin (Santa Cruz Biotechnology) or rabbit anti-HSP70 (SANTA-CRUZ) antibod- ies. Proteins were revealed using ECL clarity and the Chemidoc MP imaging system.
Confocal microscopy and proximity ligation assay
Co-immunolocalization and proximity ligation assays (PLA) were performed with cells from D7 of phase II of culture. Acquisition was made on LSM700 Zeiss confocal microscope using Zen software. Analysis was performed using Fiji.15 Detailed protocols are stated in the Online Supplemental Appendix.
Statistical analysis
Statistical analyses were performed with GraphPad Prism
2708
haematologica | 2021; 106(10)