Page 196 - 2019_10 resto del Mondo_web

E. Karampini et al.
from vWF, WPB also store angiopoietin-2, IGFBP7 and various chemokines, along with the transmembrane pro- tein P-selectin and the integral membrane protein CD63.1,3 Simultaneous release of this cocktail of inflam- matory and angiogenic mediators from WPB also pro- motes extravasation of leukocytes and vessel repair mechanisms. Weibel-Palade bodies belong to the lyso- some-related organelles (LRO), a heterogeneous group of subcellular organelles that share features with lysosomes through acquisition of recycled cargo and/or membrane components from the endo-lysosomal system.4 Biogenesis and subsequent degranulation of LRO is fun- damental to the function of a wide variety of (circulating) cells, including granulocytes, T cells, platelets and endothelial cells. Although their function and cargo differ between cell types, the mechanisms and core compo- nents that control LRO biogenesis, maturation and degranulation are shared and operate in all cells with LRO. In endothelial cells, biogenesis of WPB starts at the trans-Golgi Network (TGN) and is driven by the biosyn- thesis of vWF. At this point, other soluble cargo, as well as P-selectin, are also included in newly forming WPB. In a subsequent post-Golgi step during WPB maturation, additional key components, such as CD63, are trans- ferred from adaptor protein complex 3 (AP-3)-positive endosomes to maturing WPB.5-7 AP-3 is a heterotetramer- ic complex, consisting of four subunits: β1, δ1, β1 and s1, previously also referred to as β3A-, δ3-, μ3A- and s3A- adaptins, respectively.8 The AP-3 μ1 subunit is known to interact with membrane proteins through linear sequences of amino acid residues in their cytoplasmic tail, such as the di-leucine ([DE]XXX[LI]) and the tyrosine (YXXØ) motifs,9,10 the latter of which is also present in CD63 (GYEVM).11 When its tyrosine motif is altered or the expression of AP-3β1 is down-regulated, CD63 shows impaired trafficking to WPB, suggestive of a direct interaction between the AP-3 complex and CD63.7
Defective formation and degranulation of LRO is at the basis of a number of poorly understood congenital stor- age pool disorders (SPD) that affect secretory responses of cells. Since the mechanisms of LRO formation and degranulation are shared between different cell types, SPD are often polysystemic, affecting many cell types at the same time which leads to complex disease symp- toms. Hermansky-Pudlak syndrome (HPS) is a group of autosomal recessive disorders characterized by hypopig- mentation and platelet storage pool deficiency, due to defective maturation of melanosomes and platelet dense granules, respectively.12 HPS-2, a subtype of HPS, affects the expression and functionality of the AP-3 complex by mutations in the AP3B1 gene, which encodes the AP-3 complex β1 subunit.13 Apart from the shared HPS features of platelet dysfunction and albinism, HPS-2 is also uniquely characterized by CD8+ cytotoxic T-cell dysfunc- tion and neutropenia.14-16
Given the polysystemic nature of SPD, we sought to determine how genetic deficiencies in the AP-3 sorting machinery impact the secretory function of endothelial cells. Here we show, using blood outgrowth endothelial cells (BOEC) from an HPS-2 patient, that defects in AP-3 dependent maturation of WPB impairs the exocytotic potential of WPB by affecting the recruitment of the WPB-localized member of the SNARE fusion machinery VAMP8.
Methods
Cell culture and isolation of blood outgrowth endothelial cells
Blood outgrowth endothelial cells were isolated as previously described and cultured in EGM-2 (Lonza, Basel, Switzerland, CC-3162) supplemented with 18% fetal calf serum (FCS) (Bodinco, Alkmaar, the Netherlands) (EGM-18).17 HPS-2 BOEC were isolated from venous blood from a patient diagnosed with HPS-2 (described by de Boer et al.16), caused by compound het- erozygote AP3B1 mutations (c.177delA, p.K59Nfs*4 and c.1839- 1842delTAGA, p.D613Efs*38). The study was performed according to national regulations regarding the use of human materials. The patient’s parents signed an informed consent form allowing participation. Control BOEC were isolated from healthy, anonimized donors participating in the voluntary inter- nal blood donor system of Sanquin Blood Supply following writ- ten consent. The study was approved by the Medical Ethical Committee of the Academic Medical Center in Amsterdam and was conducted in accordance with the Declaration of Helsinki.
DNA constructs
The mEGFP-LIC and LVX-mEGFP-LIC vectors have been described before.18,19 The EGFP-AP-3β1 plasmid encoding AP-3β with EGFP fused to its aminoterminus was a gift from Dr. Adolfo Saiardi.20 To construct LVX-mEGFP-AP3-β1, a 3317 bp fragment containing the AP-3β1 coding sequence was cut from EGFP-AP-3β1 using BsrGI and SacII and pasted in frame behind mEGFP using the same sites in mEGFP-LIC. In a second step, the AP-3β1 coding sequence was excised from mEGFP-AP-3β1 using BsrGI and NotI and pasted in frame behind mEGFP in the LVX-mEGFP-LIC vector.
CRISPR genome engineering
gRNA were designed to target exon 1 of the AP3B1 gene and exon 1 and 2 of the VAMP8 gene using the CRISPR Design tool (http://crispr.mit.edu). gRNAs [(AP3B1 exon 1: gRNA-4: TACAAT- GAGCAGTCCGGAGG and gRNA-5: ACAATGAGCAGTCCG GAGGA); (VAMP8 exon 1: gRNA-4: GAATGTGGAGCG- GATCCTGG and gRNA-5: AGA ATGTGGAGCGGATCCTG; exon 2: gRNA-3: CTGGAGCGACTCGAGATGCG)] were selected based on the specificity score with the minimum amount of off-target effects and were subsequently cloned as hybridized oligos [(AP3B1: gRNA-4: RBNL306 5’-CA CCGTA- CAATGAGCAGTCCGGAGG-3’ and RBNL307 5’-AAACC- CTCCGGACTGCTCA TTGTAC-3’; gRNA-5: RBNL308 5’- CACCGACAATGAGCAGTCCGGAGGA-3’ and RBNL309 5’- AAACTCCTCCGGACTGCTCATTGT C-3’), (VAMP8: gRNA- 3: RBNL318 5’-CACCGGTGGAGGAAATGATCGTGTG-3’ and RBNL319 5’-AAACCACACGATCATT TCCTCCACC-3’; gRNA-4: RBNL320 5’-CACCGATTCACTTACTGACCGGC- CT-3’ and RBNL321 5’-AAACAGGCCGGTCAGTAAGT- GAATC-3’; gRNA-5: RBNL322 5’-CACCGA TTCACTTACT- GACCGGCCT-3’ and RBNL323 5’-AAACGGCCG- GTCTCAGTAAGTGAA TTC-3’)] into BsmBI-digested LentiCRISPR_v2 vector (a gift from Dr. Feng Zhang; Addgene #52961). A detailed protocol on transduction and clonal selec- tion of knockout BOEC has been previously described.21
CD63 and CD62P membrane exposure
Endothelial cells were cultured in gelatin-coated 6-well plates until confluency for 3-4 days prior to the experiment. In order to measure CD63 surface exposure in WT and HPS-2 BOEC under steady conditions, cells were washed twice with phosphate buffered saline (PBS), detached with Accutase (Sigma, A6964),
2092
haematologica | 2019; 104(10)