Page 128 - 2019_06-Haematologica-web

S.L. Lim et al.
S phase of the cell cycle by direct interaction with positive transcription elongation factor complex b.4 BRD 4 is often located in super-enhancer regions associated with key genes (e.g. MYC, IGLL5, IRF4, PRDM1/BLIMP-1, and XBP1). These super-enhancer driven genes are also impor- tant in MM biology, playing key roles in controlling cell proliferation.5
The BET inhibitor JQ1 has potent anti-MM activity in vitro and in vivo,6 but its reversible binding to BRD pro- teins causes incomplete transcriptional repression of MYC and other oncoproteins.7 It also does not induce apoptosis in MM. ARV 825 (Arvinas Inc., New Haven, CT, USA) is a hetero-bifunctional molecule composed of a BRD 4 binding moiety (OTX015) joined to pomalidomide. The latter binds to an E3 ubiquitin ligase, cereblon (CRBN) and OTX 015 brings the complex to the BRD molecules. These drugs are called PROTAC (proteolysis targeting chimeric molecules) causing ubiquitination of BRD, resulting in rapid and efficient degradation by proteasome activity..9,10 PROTAC have potent activity against lymphoma, leukemia, and prostate cancers.7,9-11 Their activity on myeloma models has also been described. dBET1 (com- posed of JQ1 joined to thalidomide) promoted degrada- tion of BRD 4 in an MM cell line (MM1S)12 and a recent publication showed that BET targeted PROTAC (ARV 825 and ARV 763) has anti-myeloma activity associated with decreasing MYC and Akt/mTOR.13 The authors also showed that ARV 825 was active against primary myelo- ma cells both in vitro and in vivo, and could overcome drug resistance in MM cells.13
In this study, we demonstrate that ARV 825 (8.5-500 nM) inhibited cell proliferation of 13 human MM cell lines and three fresh myeloma samples in vitro. In addition, the drug induced apoptosis, cell cycle arrest in vitro, and had growth inhibitory activity against MM cells in vivo. This PROTAC inhibited growth of MM cells resistant to either glucocorticoids or bortezomib, as well as those with t(4:14) translocation and FGFR3 and MMSET overexpres- sion (poor prognosis). We identified prominent levels of CRBN as a biomarker of responsiveness to the drug. Those MM cells resistant to ARV 825 were sensitive to another PROTAC (MZ1) relying on a different E3 ligase (VHL). We also examined 170 drugs [US Food and Drug Administration (FDA)-approved or in clinical trial] for their ability to enhance the cell inhibitory activity of ARV 825. In depth analysis showed synergy of ARV 825 with either LY3023414 (dual PI3K/mTOR inhibitors), selinexor (CRM1 inhibitor), cediranib (VEGFR inhibitor), crenolanib (PDGFRα/b and FLT3 inhibitor), GSK 1904529A (IGF-1R inhibitor), motesanib (VEGFR1/2/3 inhibitor), gilteritinib (FLT3/AXL inhibitor), LY333531 (protein kinase C inhibitor), IGC003 (CBP-EP300 inhibitor), or ruxolitinib (JAK1/2 inhibitor).
Methods
Cell culture
All cell lines were cultured and maintained in RPMI1640 con- taining 10% fetal bovine serum (FBS) and 1% penicillin-strepto- mycin (Invitrogen, Carslbad, CA, USA) at 37°C with 5% CO2. The 8226 LR5 cells were maintained in 10 nM melphalan, the 8226 P100V cells were cultured with 100 nM bortezomib for two days every two weeks. Short random repeat (STR) analysis was carried out on all cell lines used in this study.
Cell Titer-Glo luminescent cell viability assay
Three primary MM patient samples obtained from their bone marrow (BM) were plated in 96-well plates with different concen- trations of ARV 825 [dimethyl sulfoxide (DMSO) as a vehicle]. After 48 hours (h), cell viability was determined using the CellTiter-Glo® luminescent cell viability kit according to the man- ufacturer's instructions. The luminescence was measured by a luminometer (GloMax®-Multi Detection System Madison, WI, USA). All experiments were repeated at least three times. The means with standard deviations were shown.
Lentivirus production, gene knockdown and overexpression of CRBN
shRNA targeting CRBN in pLKO.1 lentiviral vector (Sequence: CCGGGCCCACGAATAGTTGTCATTTCTCGAGAAATGA- CAACTATTCGTGGGCTTTTTG) and pLX304-CRBN-V5 vector (PMID: 29764999) were a kind gift from Dr. X. Liang (Cancer Science Institute, Singapore). Luciferase vector was purchased from Addgene (plasmid #17477). Recombinant lentiviral vector and packaging vector (pCMV-dR8.9 and pMD2.G-VSVG) were co-transfected into 293 FT cells using polyethylenimine (PEI) according to the manufacturer’s instructions. Virus supernatants were harvested at 48 h and 72 h after transfection, and placed through a 0.45 μm filter. KMS11 and KMS28BM cells (1x106 per well) were seeded in 6-well plates. Cells were transduced with lentivirus vectors in the presence of 8 μg/mL polybrene (Sigma- Aldrich) for 24 h. Stable cell lines were selected with either puromycin or blasticidin.
In vivo xenografts
To access the in vivo activity of ARV 825, KMS11 expressing
luciferase (KMS11LUC) were injected into the lateral tail vein of SCID-Beige mice (n=9) versus diluent control mice (n=9). Mice were monitored for 14 days and images were taken with a Xenogen IVIS spectrum camera (PerkinElmer, MA, USA) to doc- ument engraftment before treatment was initiated. After 14 days, mice were treated with either vehicle alone (5% Kolliphor® HS15) or 5 mg/kg of ARV 825 (daily intraperitoneal injection). Tumor burden in each treatment group was photographed weekly with a Xenogen camera and the overall survival (OS) monitored.
Statistical analysis
For in vitro and in vivo experiments, the statistical significance of difference between two groups used two-tailed Student t-test and two-way ANOVA. Significant differences between experimental groups in comparison to controls are shown: *P<0.01; **P<0.001; ***P<0.0001. Means±Standard Deviation (SD) are shown.
All animal care and experimental procedures in this study com- plied with the protocol approved by the Institutional Animal Care and Use Committee at Cedars Sinai Medical Center, Los Angeles, CA,USA.
For detailed information on the materials and methods used see the Online Supplementary Appendix.
Results
ARV 825 significantly inhibits cellular proliferation and clonogenic growth of multiple myeloma cells
Structures of ARV 825 and MZ1 are shown in Figure 1A. The ARV 825 is composed of the BET inhibitor OTX 015 conjugated to the ligand for cereblon E3 ligase. Another PROTAC (MZ1) is composed of the BET inhibitor JQ1 conjugated to the ligand for VHL E3 ligase. ARV 825 was tested in a dose-dependent manner against
1210
haematologica | 2019; 104(6)