Page 76 - 2018_11-Haematologica-web

T. Toya et al.
The pathogenesis of ECD is still unclear, and whether this condition is a type of neoplasia or inflammation is a topic of debate. The high prevalence of mutations in BRAF, NRAS, and various genes involved in the MAPK pathway and the dramatic efficacy of BRAF inhibitors suggest the important role played by the BRAF and MAPK pathways in ECD development.8-11 Recently, Haroche et al. speculated that ECD could be redefined as “inflammatory myeloid neoplasia”, similar to Langerhans cell histiocyto- sis (LCH).2,12 A mouse model of LCH showed that genetic mutations in hematopoietic stem cells or immature myeloid progenitors induce misguided differentiation, and increase in pathological dendritic cells, which recruit and activate additional inflammatory cells (so-called “innocent bystanders”).13 Cavalli et al. suggested the significance of oncogene-induced senescence (OIS), a protective reaction against oncogenesis, in the recruitment of circulating nor- mal leukocytes in ECD lesions.14,15 In the context of ECD, the local production of pro-inflammatory chemokines and Th1-associated cytokines by BRAFV600E mutated cells attracts circulating normal leukocytes to the sites and con- tributes to the inflammatory activation and formation of ECD. Further basic studies are warranted to investigate the exact mechanisms of ECD.
The clinical course of ECD is quite heterogeneous, but most cases are progressive and become fatal within a few years. Little is known about the prognostic factors of ECD except that of the involvement of CNS.16 ECD diagnosis is mainly dependent on pathological findings, such as CD68+CD1a− foamy histiocyte infiltration, but the con- sensus guidelines also demand the clinical and radiological contexts for an appropriate diagnosis of the disease.5 However, our knowledge about the clinical profiles of ECD is unsatisfactory, and more information to consoli- date this “context” is required.
Herein, we conducted a nationwide survey on ECD in Japan and clarified some clinical features of this disease. Strikingly, the poor outcome observed among elderly patients and the prognostic impact of digestive organ involvement encouraged the spread of novel treatment strategies, such as vemurafenib, or other molecular target- ed therapies.17 Additionally, the prognostic value of the increased C-reactive protein (CRP) level at onset suggested the significance of the inflammatory nature of ECD patho- physiology.
Methods
Study design and participants
We conducted a postal questionnaire-based, multicenter retro- spective study on ECD. A questionnaire was simultaneously sent to the hematology, dermatology, respiratory medicine, orthope- dics, and pathology departments of the involved hospitals in Japan in July 2014, which were certified by each Japanese society. All cases were diagnosed according to the histopathological findings consistent with ECD, which typically contain infiltration of foamy or lipid-laden histiocytes and which were positive for CD68, CD163 and negative for CD1a and Langerin on immunohisto- chemical staining. The questionnaire was also sent to hospital departments containing a member who published a paper or pre- sented at an academic conference on ECD cases. The samples of the ECD lesions from the peripheral blood and/or bone marrow were also collected, if available. This study was performed in accordance with the Declaration of Helsinki and the Ethical
Guidelines for Biomedical Research Involving Human Subjects enforced on March 29, 2001. This study was approved by the ethics committees of the University of Tokyo and each participat- ing institution. Written informed consent was obtained from all patients whose ECD samples were collected. No definitive diag- nostic criteria for ECD have been published; therefore, the diag- noses were self-reported by each institute based on the patholog- ical, radiological, and clinical findings. The digestive organ means gastrointestinal tract plus the accessory organs of digestion (the pancreas, liver, and gallbladder).
Mutation analysis
Genomic DNA was extracted from each formalin-fixed, paraf- fin-embedded tissue and peripheral blood specimen using the QIAamp DNA FFPE Tissue Kit and DNA Mini Kit (Qiagen, Hilden, Germany), respectively. Polymerase chain reaction (PCR) for the detection of BRAF V600E mutation was performed using primers (TACCTAAACTCTTCATAATGCTTGC, GTAACTCAGCAGCATCTCAGGG) as previously reported.18 The products were purified with Illustra ExoStar (GE Healthcare, Tokyo, Japan), and Sanger sequencing was conducted using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and the ABI Prism 3100 Genetic Analyzer (Life Technologies, Carlsbad, CA, USA).
Statistical analysis
The numerical and categorical variables were compared using the t-test and Fisher’s exact test, respectively. Three patients diag- nosed at autopsy were excluded from the analyses of the interval from onset to diagnosis. The survival time was calculated through the Kaplan–Meier method, and the log-rank test was utilized for the evaluation of the significant differences. The effect of various parameters on survival was evaluated through univariate and mul- tivariate analyses with the use of the Cox proportional hazards regression model. ECD-related death was defined as death associ- ated with ECD (such as heart failure due to cardiac involvement and increased intracranial pressure caused by brain mass etc.). The cumulative incidence of ECD-related death was calculated in a competing risks model. The factors with P<0.05 in the univariate analyses were included in the multivariate analysis of the survival. Hazard ratio (HR) was estimated with 95% confidence intervals (CI), and the respective P values were reported from these analy- ses. Differences were considered statistically significant at P values <0.05. Statistical analyses were performed using R version 3.3.2 (The R Foundation for Statistical Computing, Vienna, Austria).
Results
Patient characteristics and affected organs
The questionnaire was sent to 3850 departments, of which 52% (2007 departments) responded. We confirmed that in Japan 75 patients have ECD, and detailed data were collected from 45 patients. One patient was exclud- ed from the analyses because of insufficient pathological validity. Table 1 shows the clinical characteristics of the remaining 44 patients. The first signs of the disease are described in Online Supplementary Table S1. The median age at initial onset was 51 (range: 23–76) years. Among the 44 patients, 28 were males (63.6%) and 16 were females (36.4%). Five, eight, nine, and 22 patients were diagnosed before 1999, between 2000 and 2004, between 2005 and 2009, and after 2010, respectively. No association between time of diagnosis and clinical features, other than treat- ment choice, was observed. Three patients were diag-
1816
haematologica | 2018; 103(11)