Page 48 - Haematologica June

950
M.W. Wlodarski et al.
number of physical malformations are also linked to DBA.1 These include (but are not limited to) craniofacial malformations, growth retardation, abnormalities in the extremities, heart defects, as well as urogenital defects.2,3 While most patients (>90%) are diagnosed within the first year of life, a minority present with anemia at birth. Hydrops fetalis due to severe intrauterine anemia is con- sidered a very rare manifestation of DBA.4 To date, a total of 10 cases of DBA-associated hydrops have been reported in single cases.5-13 The clinical outcome of these patients was poor as compared to typical DBA (3 patients died perinatally, 4 patients were steroid unre- sponsive, 2 patients required steroid therapy, and 1 had unknown outcome).
Almost all of the mutations linked to DBA have been found in genes coding for ribosomal proteins (RPs).14 These RPs include: eS7 (RPS7), uS8 (RPS15A), eS10 (RPS10), eS17 (RPS17), eS19 (RPS19), eS24 (RPS24), eS26 (RPS26), eS27 (RPS27), eS28 (RPS28), uS14 (RPS29), uL18 (RPL5), uL5 (RPL11), eL15 (RPL15), eL18 (RPL18), uL24 (RPL26), eL27 (RPL27), eL31 (RPL31), uL29 (RPL35) and eL33 (RPL35A).15-28 The RPL15 gene has so far been reported in one patient who carried a large monoallelic microdeletion involving this gene.23 Non-RP genes linked to DBA, albeit very rarely involved, are TSR2 and GATA1.26,29 RP gene aberrations lead to haploinsufficien- cy, and in many cases result in reduction in the respective RP which impairs ribosome biogenesis, affecting both the processing pathways of pre-rRNA maturation and the assembly of the large or small ribosomal subunit.30,31 TP53 is a tumor suppressor protein and transcription fac- tor that stabilizes in response to cell stress, such as DNA damage or nucleolar stress induced by ribosome biogen- esis defects.32,33 Depending on the level of stress, stabi- lized TP53 will induce cell arrest, DNA repair, senes- cence and/or apoptosis. This pathway has been promi- nently implicated in the pathogenesis of DBA, with a number of studies suggesting that TP53 stabilization lies at the heart of the loss of erythroid progenitor cells in DBA bone marrow.34-36 In addition to activating apopto- sis, DBA-linked RP gene mutations can impair cellular differentiation, alter the landscape of mRNAs on ribo- somes, and induce autophagy.36-38
Therapy in DBA depends on the severity of anemia and on the response to oral glucocorticosteroids (GCS). GCS- non-responders receive chronic blood transfusions or can undergo hematopoietic stem cell transplantation (HSCT) which is often delayed because patients can achieve treat- ment independence.39 For unknown reasons, 20% of all DBA cases can become independent of steroid treatment and/or blood transfusions by the age of 25 years.39,40 To date, however, there are no predictive genetic markers that could improve decision making for timely HSCT. Given the significant risks that are associated with HSCT,41 especially if a matched sibling donor is not avail- able, such predictive markers would be very valuable.
Here we describe 6 DBA cases associated with muta- tions in ribosomal protein gene RPL15. These patients display an unexpectedly high rate of hydrops fetalis and treatment independence, pointing to a new genotype- phenotype correlation in DBA which could be important for risk stratification.
Methods
Patients
Diagnosis of DBA was made based on typical features includ- ing aregenerative anemia with erythroid hypoplasia.1 Written informed consent was obtained from patients and/or parents prior to inclusion in this study, which was performed in accor- dance with the ethical standards of the Declaration of Helsinki. The study was approved by the institutional ethics committee (University of Freiburg, IRB n. 205/99 and n. 351/17).
Cell culture
Lymphoblastoid cell lines (LCLs) were derived from Epstein- Barr virus (EBV)-immortalization of peripheral mononuclear cells isolated from whole blood using Ficoll (GE Life Sciences) and grown in RPMI (Gibco) containing 10% fetal calf serum (FCS), 1% L-glutamine, and 1% penicillin/streptomycin, as pre- viously described.42
DNA sequencing and bioinformatics
Targeted Sanger sequencing was performed as previously reported.43 Primer sequences are available upon request. Pathogenicity of mutations, evolutionary conservation across species, and the physicochemical difference between amino acids were evaluated using standard prediction tools as outlined in Online Supplementary Table S1.
Details of pre-rRNA processing analysis, Northern blots, polysome profiling, measurement of growth rate and de novo protein synthesis are available in the Online Supplementary Methods.
Erythroid red cell culture assays
Erythroid red cell culture assays were performed as previous- ly described.36,44 Antibodies and stains for FACS analysis were PC7 or PE conjugated CD34 (Beckman coulter, Brea, CA, USA), APC conjugated CD36 (BD Biosciences San Jose, CA, USA), PE conjugated α4 integrin (Miltenyi, Paris, France), APC conjugat- ed Band 3 (kindly provided by Mohandas Narla’s lab, NYBC, New York, USA), PE/Cy7 conjugated IL-3R (Miltennyi, Paris, France), PE/Cy7 (PE)-coupled GPA (Life Technologies Carlsbad, CA, USA), and DAPI (Sigma). FACS analysis was conducted on a BD Biosciences Influx flow cytometer (BD Biosciences San Jose, CA, USA). Data were analyzed using Kaluza software (Beckman Coulter, Brea, CA, USA). Antibodies for western blotting were TP53 (Sigma #5816), phospho-TP53 (Ser15, Cell Signaling), p21 (Cell Signaling #2947), actin (Sigma #Ac-15), and eL15 (Abcam #ab130992). Primers for real-time PCR used are as follows: TaqMhupRPL15F: CAGCCATCAGGTAAGCCAA- GA; TaqMhuRPL15R: CAGCGGACCCTCAGAAGAAA; TaqMhupp21F: TTGCTGCCGCATGGG, TaqMhup21R: CCTTGTGGAGCCGGAGCT; TaqMhupactinF: CTGGAACG- GTGAAGGTGACA;TaqMhupactinR: AAGGGACTTCCTG- TAACAACGCA; TGTAGTGGATGGTGGTACAGTCAGA; TaqMB2MhF: GCGGCATCTTCAAACCTCC;TaqMB2MhR: TGACTTTGTCACAGCCCAAGATA. Real-time PCR was per- formed using the ABI 7900 Real Time PCR system and Taqman PCR mastermix (Life Technologies Carlsbad, CA, USA). Quantification of gene amplification was performed in dupli- cate using DDCt method. The expression level of each gene was normalized using the housekeeping genes: actin, and β2 microglobulin.
haematologica | 2018; 103(6)