Page 96 - 2022_01-Haematologica-web

T. Milan et al.
informed consent and project approval from the Research Ethics Boards of CHU Ste-Justine, Maisonneuve-Rosemont Hospital and Université de Montréal. RNA was extracted from samples preserved in TRIzol (Invitrogen) according to standard protocols, while DNA for methylation-sequencing (methyl-sequencing) analysis was obtained from viably conserved samples. The char- acteristics of the patients’ AML samples are shown in Online Supplementary Table S1. The model leukemias used in this study were generated as previously described.15
Human CD34+ hematopoietic stem and progenitor cell isolation and cell culture
CD34+ human HSPC were isolated from fresh umbilical cord blood, collected under informed consent at Sainte-Justine pedi- atric hospital (distributed by HémaQuébec’s Public Cord Blood Bank [Montreal, Quebec, Canada]) or CHU de Quebec and Hotel Dieu de Levis. CD34+ cord blood cells were positively selected as previously described15 and processed immediately without in vitro culture. Briefly, cord blood was diluted with phosphate-buffered saline (PBS) + citrate 0.6% (1:2) and mixed with Ficoll. After spin- ning the mixture at 2,100 rpm, for 30 min at room temperature with the lowest deceleration speed, white blood cells found at the interphase were collected and diluted with PBS (1:2). Cells were then spun at 2,100 rpm for 10 min and resuspended in PBS + citrate 0.6% + bovine serum albumin 0.5%. An isolation kit (Miltenyi Biotec; #130-100-453) composed of beads recognizing CD34+ cells was used according to the manufacturer’s protocol. The Posseld method on an AutoMACS® machine was then used to isolate CD34+ cells and the final yield was quantified using a hemocytometer. Leukemia cells lines (KG1a, THP-1, NOMO1 and MOLM-13) were grown in RPMI medium supplemented with 10% heat-inactivated fetal bovine serum, penicillin (100 U/mL) and streptomycin (100 mg/mL) at 37°C in 5% CO2. Cell lines were transfected using a lentiviral protocol as previously described.15 The shRNA sequences used are shown in Table 1.
Chromatin immunoprecipitation, RNA-sequencing and ATAC-sequencing
Cells were cross-linked using formaldehyde 1% (for 7 min, room temperature) before glycine quenching (0.125 nM, 5 min, room temperature), cell lysis and sonication (Covaris S2 sonica- tor). Protein G-coupled beads (Protein G DynabeadsTM) were incubated overnight on a rotator at 4°C with 3 mg of antibodies against different histone marks (H3: #ab1791; H3K4me3: #ab8580-100; H3K79me2: #ab3594). Sonicated chromatin was incubated with 250 mL of beads for 4 h on a rotator at 4°C before
sequential washing with: ‘Low Salt’ buffer (0.5% NP40, 15 mM KCl, 10 mM Tris pH 8.0, 1 mM EDTA), three different ‘High Salt’ buffers (0.5% Triton, 10 mM Tris pH 8.0, 100 mM [2] or 400 mM [3] or 500 mM [4] NaCl), twice in LiCl buffer (0.5% NP40, 250 mM LiCl, 10 mM Tris pH 8.0, 1 mM EDTA). ChIPed material was then eluted (buffer: 10 mM Tris pH 8.0, 1 mM EDTA) and incubated overnight at 65°C with shaking (1,200 rpm) to reverse- crosslink. An RNaseA was added (for 1 h at 37°C) and Proteinase K digestion was performed (1 h at 37°C) before DNA was puri- fied by phenol-chloroform. A TruSeq ChIP Library Preparation Kit (Illumina, #IP-202-9001) was used to construct DNA libraries as described in the manufacturer’s instructions, with polymerase chain reaction (PCR) for a total of 12 cycles using the Illumina indexed library primers. An Illumina NextSeq 500 was used to sequence samples (75 bp paired-end) according to standard Illumina protocols. For all RNA-sequencing experiments, RNA was purified from cells (1x106) in TRIzol reagent, purified on RNeasy columns (Qiagen) and then used as input for Illumina stranded Tru-seq protocols. For CD34+ cells transduced with the KM3 fusion and cultured in vitro, RNA was collected after 30 days from GFP+ cells while for all shRNA knockdown experiments RNA was collected 4 days after lentiviral transduction. Lastly, RNA from the xenografted model AML was collected from the bone marrow of mice sacrificed 24-30 weeks after injection. All sequencing in this study was performed by the genomics core facility at the Institute for Research in Immunology and Cancer. The ATAC-sequencing protocol used was based on a method published by Buenrostro et al.19 and was performed using 50,000 cells. Samples were sequenced (75 bp paired-end) according to Illumina protocols. The primers used are shown in Table 2.
DNA methylation capture sequencing
Genomic DNA from cell pellets from either KM3 patients’ samples, pooled cord blood donors (freshly isolated), cultured cells (collected after 30 days) or model AML cells (collected 24 weeks after injection) was isolated using the PureLink Genomic DNA Mini Kit according to the manufacturer’s protocol (Life Technologies, cat. #K1820-01). Three micrograms of DNA from each sample were fragmented to 140-180 bp DNA fragments using Covaris S2 (parameters: 10% duty cycle at intensity 5 for 6 cycles of 60 s with 200 cycles set at sweeping mode). Methyl- sequencing libraries for DNA methylation analysis were pre- pared using the SureSelectXT Human Methyl-Seq Target enrich- ment system (Agilent Technologies, cat. #5190-4661) according to the manufacturer’s instructions. Briefly, DNA was fragmented, purified and used for end-repair and adenylated prior to ligation
Table 1. List of primers used for shRNA-mediated knockdown of ADCY9 expression.
Target
Scramble
ADCY9 – shRNA1 ADCY9 – shRNA2
Sequence (5’->3’)
TGCTGTTGACAGTGAGCGCCCGCCTGAAGTCTCTGATTAATAGTGAAGCCACAGATGTATTAATCAGAGACTTCAGGCGGTTGCCTACTGCCTCGGA TGCTGTTGACAGTGAGCGCGACTGTCAAAACCTTTGATAATAGTGAAGCCACAGATGTATTATCAAAGGTTTTGACAGTCTTGCCTACTGCCTCGGA TGCTGTTGACAGTGAGCGCGGGTATTATTTGACTTTTAGATAGTGAAGCCACAGATGTATCTAAAAGTCAAATAATACCCATGCCTACTGCCTCGGA
Table 2. List of primers used to prepare assays for transposase-accessible chromatin (ATAC)-sequencing libraries.
Primer name
Ad1_noMX Ad2.1_TAAGGCGA Ad2.2_CGTACTAG Ad2.3_AGGCAGAA Ad2.4_TCCTGAGC Ad2.5_GGACTCCT
Primer sequences (5’->3’)
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT
88
haematologica | 2022; 107(1)