Page 231 - 2021_05-Haematologica-web

Targeting IL-10 abrogates ATL LIC
Figure 5. Tax knock down in adult T-cell leukemia/lymphoma-derived cells decreased interleukin-10 production. (A) The same experimental design as that illustrat- ed in Figure 1A was followed and secondary SCID mice were left untreated and sacrificed on a weekly basis (left). Interleukin 10 (IL-10) levels were determined by enzyme-linked immunosorbent assay (ELISA) in the supernatant of CD25+ sorted spleen cells from untreated secondary mice injected with 106 unsorted spleen cells from arsenic trioxide (AS)/interferon alpha (IFNα)-treated primary mice sacrificed at week 2 to 4 (each condition represents pooled cells from 3 mice, middle). IL-10 determined by ELISA in the supernatant of homogenized spleen-derived CD25+ and CD25– sorted cells from untreated secondary mice injected with 106 unsorted spleen cells from AS/IFNα-treated primary mice sacrificed at week 4 to 8 (right). (B) Western blot for p-STAT3 and STAT3 in untreated secondary mice injected with 106 unsorted spleen cells derived from primary mice with adult T-cell leukemia/lymphoma (ATL) treated with AS/IFNα. These secondary mice were sacrificed at weeks 4, 6 and 8. (C) Transcript levels of human IL-10 in untreated ATL-derived (HuT-102 and MT-1) or HTLV-1-negative (Jurkat) cell lines (black histograms) or after 24 h of ex-vivo treatment with AS/IFNα alone (red histograms) or combined with the proteasome inhibitor PS-341 (green histograms). (D) Transcript levels of human IL-10 in CD25– (blue histograms) or CD25+ (red histograms) sorted cells from freshly isolated peripheral blood mononuclear cells from six patients with ATL, after ex- vivo treatment with AS/IFNα. (E) IL-10 levels (ELISA) of green fluorescent protein-positive (GFP+) sorted cells from ATL-derived (HuT-102 and MT-1) or HTLV-1-negative (Jurkat) cell lines following transduction with GFP-lentiviral vectors encoding scrambled shRNA (shScr) or shRNA against Tax (shTax). Gray and red histograms corre- spond to un-transduced, shScr, or shTax transduced GFP+ sorted cells as indicated. The t-test was performed to validate significance. *P≤0.05, **P≤0.01, and *** P≤0.001. P-values ≤0.05 were considered statistically significant.
cells from either untreated or AS/IFNα-treated primary mice, were treated with an anti-NK1.1 antibody or with a mouse IgG isotype control (see experimental design in Figure 2B). NK-cell depletion was confirmed by flow cytometry based on the reduction of CD25–NK1.1+ cells (Online Supplementary Figure S2C). Importantly, NK-cell depletion abrogated the effects of AS/IFNα and restored ATL LIC activity (Figure 2B, Online Supplementary Figure S2C), confirming the critical role of NK cells of secondary recipients in the AS/IFNα-induced cure.
The contribution of innate immunity, namely macrophages and NK cells, to the therapeutic effects of AS/IFNα was further asserted by a significant increase of the production of the pro-inflammatory cytokines IL-12 and IFNγ as well as monocyte chemoattractant protein-1 (MCP-1) and macrophage inflammatory protein 1-alpha (MIP-1α) exclusively in the CD25– spleen cell population of AS/IFNα-treated primary mice sacrificed after 3 days of treatment (Figure 2C).
Arsenic and interferon-α sharply decreased interleukin-10 production by Tax-driven leukemic cells, resulting in loss of leukemic-initiating cell activity and activation of innate immunity
In addition to its effects on the production of pro- inflammatory cytokines by non-malignant cells, AS/IFNα treatment for 3 days significantly decreased the produc- tion of the anti-inflammatory cytokine IL-10 by CD25+ cells (Figure 3A), along with a significant decrease of IL-10 plasma levels (Figure 3B). Interestingly, baseline IL-10 plas- ma levels were significantly higher in ATL SCID mice than in normal SCID mice (Figure 3B). These results are quite similar to those observed in patients with ATL who dis- play high levels of IL-10 at diagnosis, with the levels decreasing sharply after treatment with AS/IFNα/AZT.23,24 In these patients, IL-10 may be produced by ATL cells and/or by HTLV-1-infected non-malignant cells,23 or even by HTLV-1-negative cells. Indeed, HTLV-1-infected non- malignant cells may provide an adequate environment for the growth of ATL cells. To mimic this situation, we used malignant cells derived from two different tax transgenic mice. We, therefore, transplanted into SCID mice ten or 106 unsorted spleen cells derived from a SCID mouse injected with malignant cells from one tax transgenic ani- mal (Figure 3C, Online Supplementary Figure S3A, black his- tograms), 106 cells derived from a second SCID mouse injected with malignant cells from another tax transgenic mouse and subsequently treated with AS/IFNα (Figure 3C, Online Supplementary Figure S3A, red histograms), or a mixture of ten cells derived from the untreated SCID mouse injected with malignant cells from one tax trans-
Table 1. List of primers. Primer
mGAPDH Forward Primer
mGAPDH Reverse Primer hGAPDH Forward Primer hGAPDH Reverse Primer IL-10 Forward Primer IL-10 Reverse Primer hIL-10 Forward Primer hIL-10 Reverse Primer IFN-γ Forward Primer IFN-γ Reverse Primer IL-12 Forward Primer IL-12 Reverse Primer mMCP-1 Forward Primer mMCP-1 Reverse Primer mMIP1A Forward Primer mMIP1A Reverse Primer Rantes Forward Primer Rantes Reverse Primer IL-15 Forward Primer IL-15 Reverse Primer
Tax Forward Primer Tax Reverse Primer
Sequence 5’ 3’
CATGGCCTTCCGTGTTCCTA
CCTGCTTCACCACCTTCTTGAT GTGGACCTGACCTGCCGTCT GGAGGAGTGGGTGTCGCTGT GTGATGCCCCAAGCTGAGA CACGGCCTTGCTCTTGTTTT GCCTAACATGCTTCGAGATC TGATGTCTGGGTCTTGGTTC TCAAGTGGCATAGATGTGGAAGAA TGGCTCTGCAGGATTTTCATG TCAAACCAGACCCACCGAA GCTGACCTCCACCTGCTGA CATGCTTCTGGGCCTGCTGTTC CCTGCTGCTGGTGATCCTCTTG CCTTGCTGTTCTTCTCTGTACCATG GCATTCAGTTCCAGGTCAGTGATG CAGCAGCAAGTGCTCCAATCTT TTCTTGAACCCACTTCTTCTCTGG CATCCATCTCGTGCTACTTGTGTT CATCTATCCAGTTGGCCTCTGTTT CGGATACCCAGTCTACGTGT GAGCCGATAACGCGTCCATCG
genic and 106 cells derived from the AS/IFNα-treated SCID mouse injected with malignant cells from the other tax transgenic animcal (Figure 3C, Online Supplementary Figure S3A, red-black dashed histograms). While the short- term treatment of primary recipients with AS/IFNα affect- ed ATL LIC activity, and resulted in prolonged survival of untreated secondary recipients, adding as few as ten malignant cells from untreated animals preserved the LIC activity of Tax-driven leukemic cells from treated animals and resulted in rapid death of secondary recipients in less than 3 weeks (Figure 3C, Online Supplementary Figure S3A). These results strongly suggest that Tax-driven leukemic cells produce IL-10, and potentially other cytokines, which prevent therapy-induced loss of ATL LIC activity through a paracrine mechanism. To test this hypothesis directly, we treated secondary recipients injected with malignant cells derived from AS/IFNα-treated primary mice, with recombinant mouse IL-10 (Rec IL-10) (Figure 3D). Upon adding Rec IL-10, the weight of the spleens of all mice increased significantly and the animals suc- cumbed to ATL in less than 3 weeks (Figure 3D).
haematologica | 2021; 106(5)
1451