Page 182 - 2021_05-Haematologica-web

J. Teramachi et al.
In order to improve therapeutic efficacy, we need to disrupt the MM niche that confers drug resistance. Therefore, we looked for novel molecules upregulated in the MM niche to be targeted, and found that proviral integrations of Moloney virus 2 kinase (PIM2) is constitu- tively overexpressed as an anti-apoptotic mediator in MM cells.5 PIM2 expression has been demonstrated to be higher in hematologic malignancies than solid cancers or their normal tissue counterparts, and highest in MM.6,7 Importantly, PIM2 can be further upregulated in MM cells in cocultures with BMSC as well as OC.5
tion at the University of Tokushima (Permission number: 240). All animal experiments were conducted under the regulation and permission of the Animal Care and Use Committee of Tokushima University, Tokushima, Japan (toku-dobutsu 13094).
Reagents
Reagents used in this manuscript are described in the Online Supplementary Appendix.
Cells and cell culture
Details of the cells and cell culture procedures are available in the Online Supplementary Appendix.
Western blotting
Cells were collected and lysed in RIPA lysis buffer (Santa Cruz, Dallas, TX, USA). For cytosolic and nuclear preparation, cells were lysed in NE-PER extraction reagent (Thermo Fisher Scientific, Waltham, MA) in accordance with the manufacturer's protocol. Western blot analysis was done with equal protein amounts of cell lysate, as described previously.13
Cell viability
Cell viability was determined using the Cell Counting Kit-8 assay (Dojindo, Kumamoto, Japan) in accordance with the man- ufacturer’s instructions. The absorbance of each well was meas- ured at 450-655 nm using an iMark microplate reader (Bio-Rad Laboratories, Hercules, CA, USA). In order to assess apoptotic cells, cells were stained with an annexinV-FITC and propidium iodide labeling kit (MEBCYTO Apoptosis Kit; MBL, Nagano, Japan) in accordance with the manufacturer’s instruction, and analyzed by flow cytometry.
Small interfering RNA transfection
Small interfering RNA (siRNA) transduction was performed as described previously.5,20 Human and mouse TAK1 siRNA were purchased from Santa Cruz. Human TAK1 siRNA was transfect- ed into MM cells using a Human Nucleofector Kit (Lonza, Basel, Switzerland). Mouse TAK1 siRNA was transfected into mouse BMSC or RAW264.7 cells using siRNA Transfection Reagent (Santa Cruz) in accordance with the manufacturer’s protocol.
Real-time reverse transcription polymerase chain reaction
RNA isolation and quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) were performed as described previously.20 The following primer sequences were used: human RANKL F: TCGTTGGATCACAGCACATCA and R: TATGGGAACCAGATGGGATGTC, human IL-6 F: TCT- GAGGCTCATTCTGCCCTCGAGC and R: AACTGGACC- GAAGGCGCTTGTGGA, human GAPDH, used as an endoge- nous control to normalize each sample, F: TGTCTTCACCAC- CATGGAGAAGG and R: GTGGATGCAGGGATGAT- GTTCTG
Adhesion assays
Adhesion assays were performed as described previously.21 Human BMSC (2×104 cells/well) were expanded in 96-well cul- ture plates. MM cells were labeled with BCECF-AM (Dojindo) for 2 hours at 37°C and 5% CO2 as described previously.22 BMSC were washed, and the fluorescence-labeled MM cells were added onto the BMSC and incubated for 4 hours. Nonadherent BCECF-AM-labeled cells were removed by gently pipetting four times. Adherent cells were quantitated in a fluo- rescence multi-well plate reader (Infinite® 200 PRO, TECAN, Männedorf. Switzerland).
Although multiple soluble inhibitors for osteoblastoge- nesis have been reported to be overproduced in MM, including IL-3,8 IL-7,9 TNF-α,10 TGF-b,11 and activin A,12 PIM2 was found to be upregulated in BMSC by these inhibitory factors acting as a common intracellular medi- ator to suppress their osteoblastogenesis.13 Moreover, we subsequently reported that PIM2 is induced in osteoclas- tic lineage cells by receptor activator of nuclear factor κ-B ligand (RANKL) to act as a critical mediator of RANKL- induced osteoclastogenesis in MM.14 Therefore, PIM2 appears to play a versatile role in tumor progression and bone destruction and bone loss in MM, and is regarded as an important therapeutic target.
TGF-b-activated kinase 1 (TAK1) is a member of the mitogen-activated protein kinase kinase (MAP3K) family, also known as MAP3K7.15,16 It was originally identified as a key kinase in transducing TGF-b signaling down to p38 mitogen-activated protein kinase (MAPK) and c-Jun and N-terminal kinase (JNK).15 Subsequently, TAK1 has been demonstrated to be associated with the activation of a wide range of intracellular signaling pathways important for various cellular functions, including the activation of nuclear factor-κB (NF-κB) and extracellular signal-regulat- ed kinase (ERK).15 Therefore, TAK1 appears to be a gate keeper to facilitate the multiple important intracellular signaling pathways. Therapeutic efficacy of TAK1 inhibi- tion has been preclinically demonstrated in different types of cancers, including mantle cell lymphoma,17 breast cancer,18 and colon cancer.19
We demonstrate here that TAK1 is constitutively over- expressed and phosphorylated in MM cells and that TAK1 acts as an upstream regulator responsible for mul- tiple signaling pathways critical for MM growth and sur- vival.1 TAK1 phosphorylation is also induced in BMSC in cocultures with MM cells, which facilitates MM cell adhesion to BMSC between very late antigen-4 (VLA-4) and vascular cell adhesion molecule-1 (VCAM-1), thereby inducing IL-6 production and RANKL expression by BMSC. Importantly, TAK1 inhibition was able to effec- tively induce MM cell death, and alleviate bone destruc- tion though suppression of osteoclastogenesis and restoration of osteoblastogenesis. Therefore, TAK1 appears to be a pivotal therapeutic target in MM to dis- rupt the key signal transduction pathways responsible for tumor progression and bone destruction.
Methods
Ethics
All procedures involving human samples from healthy donors and patients were performed with written informed consent in accordance with the Declaration of Helsinki and a protocol approved by the Institutional Review Board for human protec-
1402
haematologica | 2021; 106(5)