Page 84 - Haematologica April 2020

Y. Xie et al.
transfusion varies significantly among patients who have undergone similar treatment protocols at similar intensi- ties. Sensitivity of erythrocytes to the cytotoxicity of chemotherapy and the recovery rate of erythropoiesis are contributing factors related to the severity and dura- tion of the anemia. Genetic diversity in genes regulating these response processes can be a cause for the variations between patients. Uncovering the genetic basis for the variable response is important for understanding the molecular mechanisms underlying erythropoiesis and its relationship to chemotherapy-induced anemia.
In this study, we performed genome-wide association study (GWAS) analyses of samples from individuals who had undergone multiple RBC transfusions (MRT) and from those who received no RBC transfusion (NRT) when a remission was achieved. By counting the cell line, pri- mary bone marrow (BM) cells, and considering the results of animal model and human genetic studies, we suggest a novel molecular pathway involved in erythroid regenera- tion in ALL patients after chemotherapy.
Methods
Patients
From January 1st 2001 to December 31st 2014, a total of 452 patients diagnosed with childhood ALL were recruited in this study. The patients included were enrolled on Shanghai Children’s Medical Center -Acute Lymphoblastic Leukemia- 2005 (SCMC-ALL-2005) protocol. Standard induction and con- solidation chemotherapy were used. Blood transfusion records were collected from the transfusion department of SCMC and clinical data were reviewed to exclude the events needed for additional transfusions of RBC, such as transplantation, gas- trointestinal bleeding, surgery, etc. Patients who abandoned treatment or who died were not included in this study. Only total RBC transfusion units after achieving complete remission was included in the count and this number was normalized by body surface area (Unit/m2) to exclude the influence of patient's age, mass, and the disease itself on blood transfusion units. Patients who received more than eight RBC units/m2 were defined as MRT. This study has been approved by Shanghai Children's Medical Center Ethics Committee (n. SCMCIRB- K2018052).
Dual Luciferase reporter assays
A total of 933 bp DNA fragments surrounding rs10892563 CC and TT genotype were cloned into the firefly Luciferase vector pGl4.27 (Promega); 293T cells were transfected with 5 g PRL-TK vector and 300 ng PCDNA3-Flag expression GATA1 via lipo- fectemin. Luciferase activity was measured in a Varioskan Flash spectral scanning multimode reader (Thermo) using the Dual- Luciferase Reporter Assay system kit (Promega).
Targeted single nucleotide polymorphism genotyping by polymerase chain reaction
The candidate SNP rs10892563 on ARHGEF12 at position 119,729,754 bp was analyzed by polymerase chain reaction (PCR) on 381 ALL patients enrolled in the SCMC-ALL-2005 protocols for which genomic DNA samples were still available. The DNA seg- ment containing the candidate mutation was amplified by PCR using the following primers:
5’-00ATAGGGATACCTGGCCCCTA-3′ and 5’- ndATAGGGATACCTGGCCCCTA-3′
These PCR products were subsequently Sanger sequenced.
Table 1. Morpholino sequences and concentrations used in this study.
Target
arhgef12a MO arhgef12a MIS arhgef12b MO arhgef12b MIS
Sequence
Concentration (mM)
TGACTGTAGACCGTGTGTCGCTCAT 0.5 TGAgTcTAcACCGTcTcTCGCTCAT 0.5 CACCAGTCTGAACACCAGCTCGCAT 0.5 CACgAcTCTcAACACgAcCTCGCAT 0.5
Whole-mount in situ hybridization
The antisense probes of arhgef12a and arhgef12b were obtained
by PCR with the primers
(arhgef12a forward primer, 5’-GCGGAATTCCCACCTCAAG-
GAGATGGAAA-3’;
reverse primer, 5’-GCGGGTACCCCAAAAGCATGCAA-
GAAACA-3’;
arhgef12b forward primer, 5’-GCCGAATTCTCCAGCAT-
GAGTGGTTGGTA-3’;
reverse primer, 5’-ATTGGTACCCTCAACAGAAAGCCGA-
GACC-3’), and added with EcoR1/Kpn1 restriction enzyme sites for cloning into pCS2+ vector. Antisense digoxigenin (DIG)– labeled RNA probes were generated by in vitro transcription and whole-mount in situ hybridization (WISH) was performed as described previously.1 The results were imaged using a stereomi- croscope Nikon SMZ1500 with a 1 x HR Plan Apo objective and ACT-1 vision software.
Micro-injection
One-cell-stage embryos were injected with 2 nL of morpholino (MO) or mismatch morpholino (MIS) mixes (arhgef12a and arhgef12b) purchased from Gene-Tools. The MO sequences and concentrations are listed in Table 1.
CRISPR/Cas9 mutagenesis
The arhgef12a gRNA (5'-GGACGTGGGTCTCGAGTCAC-3') and arhgef12b gRNA (5'-GGAATCTGAGGCAGGCCCGG-3') were synthesized. The zebrafish optimized Cas9 mRNA was syn- thesized in vitro from the pCS2-nCas9n plasmid (addgene, #47929) as described.2 The Cas9 mRNA was synthesized in vitro by SP6 mMessage mMachine Transcription Kit (Ambion). arhgef12a gRNA (50pg), arhgef12b gRNA (50pg), and Cas9 mRNA (150pg) were co-injected into one-cell stage embryos.
Statistical analysis
Results are expressed as mean±standard deviation considering the number of experiments. Statistical comparisons between groups were performed by two-tailed t-test or one-sided t-test using Graphpad Prism version 6.0.
Other methods
Whole exome sequencing, GWAS, cell sorting, quantitative real- time (qRT)-PCR, plasmid construction, in vitro RNA synthesis, micro-injection and anisomycin treatment were performed as described in the Online Supplementary Appendix.
Results
An ARHGEF12 polymorphism in acute lymphoblastic leukemia patients is associated with susceptibility to chemotherapy-induced anemia
We performed whole exome sequencing in 31 individu- als who had undergone at least eight RBC transfusions
926
haematologica | 2020; 105(4)