Page 193 - 2019_05-HaematologicaMondo-web
P. 193
Mechanism of KDSR-associated thrombocytopenia
Stem cell differentiation assays
CD34+ hematopoietic stem cells (HSC) were isolated by mag- netic cell sorting (Miltenyi Biotec, Bergisch Gladback, Germany) from BM aspirates from the propositus (at 5 years of age) and an unrelated control, and from peripheral blood (PB) from the propositus (at 8.5 years of age), his affected sister (at 5 months of age), and an unrelated control.
In addition, expanded BM- and PM-derived12,13 HSC at day 3 of differentiation were used for liquid MK cultures in two experi- ments. In the first experiment, HSC obtained from the BM of the propositus were differentiated in parallel to a control. For the sec- ond experiment, HSC obtained from the PB of the propositus and his affected sister were cultured in parallel with a different control. Details of the differentiation protocols, colony assays and statisti- cal analysis of megakaryocyte (MK) immunostaining are provided in the Online Supplementary Methods.
Zebrafish analysis
Tg(cd41:EGF) embryos14 were injected at the one-cell stage with a kdsr ATG morpholino (MO) (5’ ctcagaggacatgggtcaacctgat, Kdsr- MO) purchased from Gene Tools LLC (Philomath, OR, USA) or with buffer (control). Zebrafish kdsr has ZFIN accession number
ZDB-GENE-040426-853. Thrombocyte formation was analyzed as described previously.15,16 Immunoblots were developed with goat anti-GFP (Rockland) and anti-FVT1/KDSR (Clone H-149; Santa Cruz, CA, USA). All animal protocols were approved by the Ethical Committee of KU Leuven, Belgium.
Lentiviral reference 3-keto-dihydrosphingosine reductase transcript expression in induced pluripotent stem cells
Induced pluripotent stem cells (iPSC) were prepared by the Cambridge Biomedical Research Centre iPSC core laboratory as described in the Online Supplementary Methods. iPSC were trans- duced with the lentiviral vector to express the open reading frame (ORF) of KDSR (pLenti-EF1a-KDSR-myc-DDK-IRES-Puro, Origene) and the un-cloned destination vector PS10085 (Origene) to generate the reference transcript rescue line (Kresc) and empty vector control line (Kev), respectively. The ORF is identical to tran- script ENST00000591902 (RefSeq accession n. NM_002035, Origene TrueClone cDNA cat. RC201153), which has the highest reported expression in MK.2 Details of lentiviral particle produc- tion, transduction and selection are given in the Online Supplementary Methods.
A
BC
Figure 3. Metabolic profiling shows that the KDSR variants are associated with loss-of-function and downstream sphingolipid pathway compensation. (A) Simplified sphingolipid pathway highlighting the role of the 3-keto-dihydrosphingosine reductase (KDSR) enzyme in de novo synthesis (black arrows) and the generation of sphingolipid intermediates from the recycling of complex sphingolipids and sphingomyelins (green arrows). (B) Mass spectrometry using the Metabolon platform shows the major chromatographic peak of 3-keto-dihydrosphingosine (KDS) in the plasma of the propositus, but not of the unaffected pedigree members (shown) or the controls (data not shown). (C) KDSR hypofunction was confirmed in the propositus and affected sister using a second mass spectrometry platform for targeted sphingolipid profiling. The chromatogram shows that KDS was detected in the plasma from the propositus and his affected sister but not in the plasma from the healthy brother, parents (shown), and two controls (data not shown).
haematologica | 2019; 104(5)
1039

